HIV, SARS(-CoV-2), and All That Jazz

Time to connect the dots in this "lab or nature" SARS-CoV-2 saga.

I start with the backgrounder on Moderna, the reason for which will become obvious in due course. Then the battle in the media, of the last 2 years, over the lab vs natural origin of SARS-CoV-2 is summarized, followed by a sidebar on the furin cleavage site. At last, the factual material is presented as to the “SARS-CoV-2 as the HIV-spiked SARS in the lab” conspiracy, with fact-checkers given a fair chance to debunk this crazy idea.

The brave little Moderna, after its tremendous and equally unexpected success with highly efficacious and extremely safe Covid-19 mRNA jabs, decided not to rest on the proverbial laurels and switched its attention to the HIV vaccines. So maybe it’s highest time to dispel any lingering doubts and misconceptions regarding this fine specimen of BigPharma, in case we had any left?

Like the one that Moderna grew out of a US National Science Foundation’s grant # 0434507 called “Darwinian Chemical Systems”, aiming “to synthesize chemical systems capable of Darwinian evolution, based on the encapsulation of self-replicating nucleic acids in self-replicating membrane vesicles.“ “In a post-extinction event, we want to see if we can get mRNA to write into DNA the code to start human evolution again.” Or that Moderna didn’t shy away from “hacking the kingdom of life”, as it were: ”If you can hack the rules of mRNA, "essentially the entire kingdom of life is available for you to play with," says Hoge, a physician by training who left a position as a health care analyst to become Moderna's president in 2012. Adjusting mRNA translation to fight disease "isn't actually super high-risk biology," he adds.” So play they did. Same Moderna in deep trouble as recently as 2017 with its revolutionary mRNA gene therapies (even more recently dubbed “vaccines”). Or that Moderna’s CEO Stéphane Bancel is a WEF stooge, sorry, Global Leader of Tomorrow alumnus, and agenda setter? Who doesn’t need a healthy dose of globalist eugenicist-slash-depopulation cadre nowadays?

Or that Moderna was getting research funds from DARPA since 2013, but then forgot to mention this fact when filing for patents. Or that Moderna enters into "Confidential Disclosure Agreement 2015-33448" with NIH (Fauci) to develop mRNA vaccines. Or that 6 months prior to the purported release of SARS-CoV-2 in Wuhan Moderna enters into a “research collaboration agreement” with NIH to develop “vaccine candidates against Middle East Respiratory Syndrome coronavirus (MERS-CoV) and Nipah virus”. Or that in Dec. 12, 2019 Moderna signs a Material Transfer Agreement "of the mRNA Coronavirus vaccine candidates developed and jointly-owned by NIAID and Moderna to The University of North Carolina at Chapel Hill" for "Perform challenge studies with the mRNA vaccine in a <proprietary info: mammalian?> model as described on Exhibit A" Signed by Ralph Baric. Same Ralph Baric that conducted gain-of-function research on coronaviruses since at least the early 2000s, with notable successes. Same Baric that in Jul. 2003 successfully created "an infectious clone of the urbani strain of the SARS coronavirus". Make a note of this SARS fact as it will be important in the discussion below. Moderna seems to be a go-to intermediary for Fauci/NIH whenever he/it dealt with Baric’s risky research goals. In particular that NIAID (part of NIH) patented in Oct. 25, 2016 the now-famous S spike protein “stabilized in its prefusion conformation”, U.S. Application No. 16/344,774 "Prefusion Coronavirus Spike Proteins and Their Use", Priority to US201662412703, US patent US10960070B2 granted 2021-03-31.

After this introductory dump of factual information about Moderna, NIH/NIAID (Fauci), and MERS/SARS/SARS-CoV-2, let’s return to HIV. Some said as early as January 2020 (mostly hapless scientists and the conspiracy types) that SARS-CoV-2 is a cross between SARS and HIV (the PRO side), while others (mostly fact-checkers and the true $cience believers) vehemently denied the slightest and remotest possibility thereof (the CONTRA side).

For the conspiracy types to be right, it is also a must that the SARS-COV-2 virus be man-made/lab-cooked and lab-leaked. Not so, said Fauci back in Feb. 2020, and the scientific consensus promptly closed its ranks behind him. NY Post describes the curious details on how this consensus came into being in its article from June 2, 2021, “Fauci was warned that COVID-19 may have been ‘engineered,’ emails show“: “On Jan. 31, 2020 …Fauci sent an email to US virus researcher Kristian Andersen and Sir Jeremy Farrar, who runs a global health charity in Britain. Fauci forwarded them a copy of a Science magazine article titled, “Mining coronavirus genomes for clues to the outbreak’s origins.” “This just came out today. You may have seen it. If not, it is of interest to the current discussion.”“

Just two days later, on Feb. 2, 2020, Farrar sent a brief email to Fauci and other US health officials in which he asked for a conference call “later tonight or tomorrow” to discuss their response to a pending announcement from the WHO. Farrar then added, “Meanwhile….” and a link to an article at the ZeroHedge website with the headline, “Coronavirus Contains ‘HIV Insertions’, Stoking Fears Over Artificially Created Bioweapon.”

Lo and behold, the correct interpretation of facts on the ground started building, culminating in the same Kristian G. Andersen, this time et al., standing firmly on the side of Truth and the natural origin of the ignominious virus: ”The proximal origin of SARS-CoV-2” (the Journal Nature Medicine, 2020.03.17): “While the analyses above suggest that SARS-CoV-2 may bind human ACE2 with high affinity, computational analyses predict that the interaction is not ideal and that the RBD sequence is different from those shown in SARS-CoV to be optimal for receptor binding. Thus, the high-affinity binding of the SARS-CoV-2 spike protein to human ACE2 is most likely the result of natural selection on a human or human-like ACE2 that permits another optimal binding solution to arise. This is strong evidence that SARS-CoV-2 is not the product of purposeful manipulation.“ In other words, the tools that we would use wouldn’t predict these modifications. Tada!

That didn’t stop some pesky “scientists” from having further doubts, though.

“The genetic structure of SARS-CoV-2 does not rule out a laboratory origin“ (BioEssays, 2020.11.17): “Both cleavage site and specific RBD could result from site-directed mutagenesis, a procedure that does not leave a trace. Considering the devastating impact of SARS-CoV-2 and importance of preventing future pandemics, researchers have a responsibility to carry out a thorough analysis of all possible SARS-CoV-2 origins.“

And lately, under the weight of the new compromising information, the hypothesis of the lab origin of the SARS-CoV-2 became kosher again:

1. “Origins of SARS-CoV-2: Why the lab-leak idea is being considered again“(The Conversation, 2021.06.06): “The possibility resurfaced in recent weeks, placing Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases (NIAID), in an embarrassing situation. …The United States was funding this research laboratory and …the projects being funded there focused on gain-of-function studies. An opinion piece published in the Wall Street Journal claims that NIAID may have supported some of these experiments that were underway at Wuhan Institute of Virology.“

2. “Scientists believed Covid leaked from Wuhan lab - but feared debate could hurt ‘international harmony’“ (The Telegraph, 2022.01.11): “In the emails, Sir Jeremy said that other scientists also believed the virus could not have evolved naturally. One such scientist was Professor Mike Farzan, of Scripps Research, the expert who discovered how the original Sars virus binds to human cells. Scientists were particularly concerned by a part of Covid-19 called the furin cleavage site, a section of the spike protein which helps it enter cells and makes it so infectious to humans. Summarising Professor Farzan’s concerns in an email, Sir Jeremy said: “He is bothered by the furin site and has a hard time (to) explain that as an event outside the lab, though there are possible ways in nature but highly unlikely.“

3. The publishing/leak of the DEFUSE Proposal of EcoHealth Alliance from March 2018, where Peper Daszak is laundering Fauci’s NIH money on behalf of Ralph Baric/UNC Chapel Hill. The Task 4 of this DEFUSE (like in DETONATE) proposal is formulated like so: “LTA-01Task 4: Experimental assays of SARS-CoV QS jump potential (UNC)

   • Subtask 4.1 Conduct pre-screening via structural protein modeling, mutation identification, ‘pseudovirus assays. (UNC).

   • Subtask 4.2 Conduct in vitro testing of chimeric viruses against host cell lines (UNC).

   • Subtask 4.3 Assess in vivo pathogenesis in hACE2 transgenic mice (UNC).

   • Subtask 4.4 Validate results from chimeric viruses with full-genome GS (UNC).

   • Subtask 4.5 Test synthetic modifications to viral spike proteins including RBD deletions, S2 Proteolytic Cleavage and Glycosylation Sites, N-linked glycosylation (UNC).

   • Subtask 4.6 Test effects of low-abundance, high-consequence micro-variations on jump potential. (UNC)“

   So, who needs a bigger smoking gun than this? Ralph Baric of UNC Chapel Hill would test in Wuhan Moderna-patented, NIH/Fauci enabled (Patent: GP 2017197545-A 7090 Nov. 2, 2017; see below for the evidence) synthetic modifications to SARS spike protein, including the furin cleavage site (S2 Proteolytic Cleavage and Glycosylation Sites). Why don’t we hear of a string of arrests as of yet? FBI, CIA, NSA, somebody, anybody?

4. “Tidal Wave of Documents on Gain-of-Function and the Leak of the Virus“ (Robert W. Malone, 2022.01.12).

5. “Bombshell: Project Veritas Releases Military Documents That Contradict Fauci’s Sworn Testimony on Gain of Function Research” (VIDEO, Alex Jones, 2022.01.11)

The acrimonious furin cleavage site has been mentioned a few times now, and will be below, so a sidebar is in order. According to Wikipedia, “Furin is a protease enzyme that in humans and other animals is encoded by the FURIN gene. Some proteins are inactive when they are first synthesized, and must have sections removed in order to become active. Furin cleaves these sections and activates the proteins. It was named furin because it was in the upstream region of an oncogene known as FES. The gene was known as FUR (FES Upstream Region) and therefore the protein was named furin. Clinical significance: Furin is one of the proteases responsible for the proteolytic cleavage of HIV envelope polyprotein precursor gp160 to gp120 and gp41 prior to viral assembly.“ To further elaborate on the role of furin in HIV virus assembly, “Furin‐mediated protein processing in infectious diseases and cancer“ (Clin Transl Immunology., 2019.08.05): “Retroviral glycoprotein trimers, such as those of human immunodeficiency, Rous sarcoma or murine leukaemia

In case of HIV‐1, the gp160 precursor of the viral envelope protein (Env) is cleaved into gp120 and membrane‐anchored gp41 that remain associated through noncovalent interactions. Cleavage occurs in intracellular compartments, before the assembly of virions at the plasma membrane.“ I refer you to the study for more details on how HIV virus is assembled and maturated before being released from an infected cell.

To add more detail on the role of furin cleavage site in SARS-CoV-2 in particular, “Furin cleavage site in the SARS-CoV-2 coronavirus glycoprotein”: “The nature of the cell protease that cleaves the S glycoprotein varies according to the coronavirus. The MERS-CoV S glycoprotein contains a furin cleavage site and is probably processed by these intracellular proteases during exit from the cell. The virus particles are therefore ready for entry into the next cell. In contrast, the SARS-CoV S glycoprotein is uncleaved upon virus release from cells; it is likely cleaved during virus entry into a cell. Examination of the protein sequence of the S glycoprotein of SARS-CoV-2 reveals the presence of a furin cleavage sequence (PRRARS|V). The CoV with the highest nucleotide sequence homology, isolated from a bat in Yunnan in 2013 (RaTG-13), does not have the furin cleavage sequence. Because furin proteases are abundant in the respiratory tract, it is possible that SARS-CoV-2 S glycoprotein is cleaved upon exit from epithelial cells and consequently can efficiently infect other cells. In contrast, the highly related bat CoV RaTG-13 does not have the furin cleavage site.“

So, the furin cleavage site is not in the most-related bat coronavirus. Hmm… Whom to trust?! Let's review and weigh the arguments of both sides, conspiracists and fact-checkers/$cience, from the vantage point of “hind sight 2022.02”:

PRO (conspiracists): An erstwhile study preprint from Jan. 31, 2020, “Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag.“ A group of Indian scientists compared the original SARS virus genome with that of Wuhan SARS-CoV-2. To their great surprise, the S spike genome was identical, but for 4 notable insertions (which put the passage from the DEFUSE proposal’s Subtask 4.6, “low-abundance, high-consequence micro-variations“, in the proper light): “We compared the spike glycoprotein sequences of the 2019-nCoV to that of the SARS CoV …[and] found that the 2019-nCoV spike glycoprotein contains 4 insertions (fig.2)”

As viruses naturally mutate all the time, it is to be expected that some nucleotides may be replaced by others, or one-two get inserted here and there. But 4 distinct non-trivial inserts point to a hand of man, rather than an act of God: “To our surprise, these sequence insertions were not only absent in S protein of SARS but were also not observed in any other member of the Coronaviridae family (Supplementary figure). This is startling as it is quite unlikely for a virus to have acquired such unique insertions naturally in a short duration of time.“

Let’s have a close look at these inserts. “To know the source of these insertions in 2019-nCoV a local alignment was done with BLASTp using these insertions as query with all virus genome. Unexpectedly, all the insertions got aligned with Human immunodeficiency Virus-1 (HIV-1). Further analysis revealed that aligned sequences of HIV-1 with 2019-nCoV were derived from surface glycoprotein gp120 (amino acid sequence positions: 404-409, 462-467, 136-150) and from Gag protein (366-384 amino acid) (Table 1).“

Although the inserts 1 and 2 are unchanged between SARS-CoV-2 and HIV-1, the inserts 3 and 4 lose some nucleotides going from HIV-1 to SARS-CoV-2. Which, coincidentally, makes the S spike stick better to its target (human ACE2 receptors), as do the inserts 1 and 2, according to the study authors. I am now also quoting from the article of Dr. Ah Kahn Syed “How to BLAST your way to the truth about the origins of COVID-19“ (Dec. 31, 2021): “These were not just random sequences from HIV. In his paper, Pradhan went further and recreated the structure of the virus with location of the four inserts. Lo and behold, these “random” inserts – all from HIV – are all at binding sites of the coronavirus”:

What are the odds? But we are not done yet. The 4th insert, QTNSPRRARS, contains the ill-famous by now furin cleavage site PRRAR.

The following large excerpt is also from “How to BLAST your way to the truth”: “Now, this is really interesting because not only have we seen that the QTNS section is derived from HIV but there is something very special about the adjacent PRRAR because that is a furin cleavage site and as we have seen, these don’t exist in this type of SARS-like virus. It’s an insertion to the viral genome, but nobody really knows how it got there (just like the HIV sequences). In order to see where it came from we need to look outside the amino acid sequence and back to the genome sequence. …The genome sequence that you can see for this amino acid sequence is: CAGACTAATTCTCCTCGGCGGGCACGTAGT which is 30 nucleotides coding for 10 amino acids. For this sequence to arise by chance would be an infinitesimally small probability, so it has to have arisen somewhere (i.e. from another virus) or else some of it must be synthetic.

BLAST is the NCBI/NIH (aka US government) repository for genomic and proteomic sequences, amongst other things. It is where all genome scientists around the world deposit their sequences if they make a discovery. Its main function is to allow comparison of gene sequences and discovery of sequences that match one that you might have come across in your experiment. So let’s BLAST(n) it, and this time we exclude “synthetic constructs” from our search (because we are looking for real viruses, not synthetic ones). What do we get?

We can see that the only viral sequences in here are synthetic, and if you were to click on each of these you would find their registration date after Feb 2020. In other words, no virus in existence has this genetic sequence. Well this is strange, because in order for a virus to acquire a large sequence like this it has to get it from another organism. It has no lab to manipulate gene sequences, neither do the bats (hence Jikky the lab mouse’s little joke)…

So, where did this code come from? Well it turns out that BLAST can tell us – with some degree of certainty – where some of this code, particularly the bit that codes for the PRRAR section (the furin cleavage site which is so unique), came from. The bit that we are interested in is in the clue from Jikky. CTCCTCGGCGGGCACGTAG. Let’s BLAST it:

What you see is the same (misclassified SARS-CoV-2) sequences in the first 9 hits, and then none of the remaining hits have 19/19 matches. What this means is that there is no virus known to man that has this particular sequence in its genome prior to the discovery of SARS-Cov-2. So where on earth has it come from? For this you need to select a different database. Let’s go back to the BLASTn query screen and change the database option to “Patent sequences (pat)”. Remove all the exclusions and run the BLAST.

The results here need a little bit of sifting through because the top of the list include results from patents from this year. They are prefixed WO2021 and WO2020 so can be ignored. Just below those are the ones that we are interested in. I have just highlighted the top three but the whole list of many are patents owned by the same company, you just have to click on the accession number on the right.

So let’s do it and see which company, that we all know (now), that is a pharma company that has never produced a working drug yet has a market cap of over $80bn…

Yes, that’s right. Every single one of these patents that contains that 19-nucleotide sequence (for which the probability of occurring by random chance is less than 1 in a billion) is from Moderna. [Note the sequence is actually the reverse complement sequence but this is likely a direct result of the cell lines that it occurred in – MSH3_mutated cell lines designed for developing cancer vaccines, the Moderna patent was actually for a mutated MSH3 gene for this purpose]. In order for that sequence to have arisen in that virus, the virus which was manufactured with its HIV inserts, had to have had been infected into patented cell lines supplied by Moderna that had that unique sequence not seen in any other virus.

In theory nothing is impossible in science, medicine or genomics. A SARS virus emerging naturally with 3 HIV inserts at its binding sites and also containing a furin cleavage site that doesn’t exist in nature but does exist in a Moderna patent… that’s seriously crazy talk. It doesn’t exist. A flying pink elephant would be a million times more likely.

For even more coverage of Moderna patenting the key piece of SARS-CoV-2 years prior to the said virus “emergence of the unlikely union of a bat and a pangoline in Wuhan’s wet market, read this article from the Naked Emperor:

CTCCTCGGCGGGCACGTAG

If that wasn’t enough, there is a purported email to Tony Fauci from one Adam Gaertner on March 11, 2020 titled “Coronavirus bioweapon production method“ where the cooking recipe for such bioweapon is spelled out with ingredients, temps and timings (“BIG: Is This The Email That Will Spell Dr. Anthony Fauci’s Doom?“, conservativeworldnews.com, 2021.06.03). Wonder why this isn’t talked about more widely. Get you booster, BTW!

This completes the PRO arguments.

CONTRA (fact-checkers, $cience):

1. “Fact check: SARS-CoV-2 was not created using genes from HIV, Fauci does not hold patents for an ‘HIV component’ to SARS-CoV-2” (Reuters, 2021.01.07): “Fact checker Health Feedback addressed the withdrawn report here and found that “the sequences analyzed by the study authors were so short that it is easy to find similarities to a wide variety of organisms”.“ I am speechless at the depth of such “everything tastes like chicken“ argumentation.

2. “Coronavirus is not genetically linked to HIV” (AP, May 28, 2020): “The paper was posted by Indian scientists who said they had found “uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag.” At the time, the paper was widely debunked by scientists on social media. It was withdrawn from bioRXIV following the criticism.“ So, debunked by scientists at the time using social media. A good one, AP!

3. “The Origins and Scientific Failings of the COVID-19 ‘Bioweapon’ Conspiracy Theory“ (Snopes, 2020.04.01): “The paper was swiftly retracted by the authors, according to STAT News, with commenters noting the study’s rushed methods and likely coincidental, if not entirely incorrect, conclusion. A Feb. 14 paper, this one peer-reviewed, “demonstrated no evidence that the sequences of these four inserts are HIV-1 specific or the [SARS-CoV-2] viruses obtain these insertions from HIV-1.” “As for the second notable SARS-CoV-2 adaptation [furin cleavage site]— the one that allows a chemical in human blood to activate the coronavirus spikes — this specific modification has not yet been found in nature.” All coincidental, whatever that means. And swiftly retracted. Take that!

4. “Genomic Study Points to Natural Origin of COVID-19“ (NIH Director’s Blog, meaning that it is directly from under Dr. Anthony Fauci’s desk, 2020.03.26): “The reassuring findings are the result of genomic analyses conducted by an international research team, partly supported by NIH. In their study (The proximal origin of SARS-CoV-2, 2020.03.17) in the journal Nature Medicine, Kristian Andersen, Scripps Research Institute, La Jolla, CA; Robert Garry, Tulane University School of Medicine, New Orleans; and their colleagues used sophisticated bioinformatic tools to compare publicly available genomic data from several coronaviruses.” They conclude that their sophisticated tools are not sophisticated enough as they produce wrong results, and anyone using these tools would have never come up with the 4 inserts in question: “…any bioengineer trying to design a coronavirus that threatened human health probably would never have chosen this particular conformation for a spike protein. This study leaves little room to refute a natural origin for COVID-19. And that’s a good thing because it helps us keep focused on what really matters: observing good hygiene, practicing social distancing.“ We did not do it because we are too stupid for this. Wear masks and wash your hands, folks.

So, which side’s arguments are more convincing to you? Do you believe in $cience, or are you falling for a “conspiracy”?

Let me know if I need to add more details to any of the above before you can make an informed decision.